pRNA-H1.1/Hygro/siRLuc (GWM-VEC010)

GWM-VEC010

10ug
$270.00

Description

Description: :pRNA-H1.1/Hygro/siRLuc is a GenWay siRNA expression vector. It is designed for mammalian transfection. It uses H1 promoter for siRNA expression. This vector contains siRNA construct for Renilla luciferase, and can be used as a positive control. It can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion.

Detailed Map: Polylinker: 4819 - 4888 H1 Promoter: 4719 - 4818 SV40 Promoter: 597 - 942 Hygromycin: 965 - 1990 pUC ori: 2660 - 3300 Ampicillin: 3448 - 4308

Forward Sequencing Primer: GWM-PR0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)

Reverse Sequencing Primer: GWM-PR0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Storage: Store at -20C

Limited Use Label License: None

Additional Information

Name pRNA-H1.1/Hygro/siRLuc (GWM-VEC010)
Related Product Names pRNA-H1.1/Hygro/siRLuc
Datasheets/Manuals Printable datasheet for GWM-VEC010
Storage Store at -20C
Intended Use Research Use Only