pRNA-H1.1/Neo/siRLuc (GWM-VEC013)

GWM-VEC013

10ug
$270.00

Description

Description: :pRNA-H1.1/Neo/siRLuc is a GenWay siRNA expression vector. It is designed for mammalian transfection. It uses H1 promoter for siRNA expression. This vector contains siRNA construct for Renilla luciferase, and can be used as a positive control. It can also be used as a siRNA vector using BamH I and Hind III for siRNA insertion.

Detailed Map: Polylinker: 4700 - 4769 H1 Promoter: 4600 - 4699 SV40 Promoter: 647 - 992 Neomycin: 1033 - 1827 pUC ori: 2541 - 3181 Ampicillin: 3329 - 4189

Forward Sequencing Primer: GWM-PR0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)

Reverse Sequencing Primer: GWM-PR0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Storage: Store at -20C

Limited Use Label License: None

Additional Information

Name pRNA-H1.1/Neo/siRLuc (GWM-VEC013)
Related Product Names pRNA-H1.1/Neo/siRLuc
Datasheets/Manuals Printable datasheet for GWM-VEC013
Storage Store at -20C
Intended Use Research Use Only