pRNA-U6.1/Hygro/siRLuc (GWM-VEC011)

GWM-VEC011

10ug
$270.00

Description

Description: :pRNA-U6.1/Hygro/siRLuc is a GenWay siRNA expression vector. It is designed for mammalian transfection. It uses a U6 promoter for siRNA expression. This vector contains siRNA construct for Renilla luciferase and can be used as a positive control. It can also be used as an siRNA vector using BamH I and Hind III for siRNA insertion.

Detailed Map: Polylinker: 78 - 147 U6 Promoter: 5044 - 77 SV40 Promoter: 896 - 1241 Hygromycin: 1264 - 2289 pUC ori: 2959 - 3599 Ampicillin: 3747 - 4607

Forward Sequencing Primer: GWM-PR0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)

Reverse Sequencing Primer: GWM-PR0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Storage: Store at -20C

Limited Use Label License: None

Additional Information

Name pRNA-U6.1/Hygro/siRLuc (GWM-VEC011)
Related Product Names pRNA-U6.1/Hygro/siRLuc
Datasheets/Manuals Printable datasheet for GWM-VEC011
Storage Store at -20C
Intended Use Research Use Only