



Description: :pRNA-U6.1/Neo/CTL is a general-purpose siRNA negative control vector from GenWay. It is designed for mammalian transfection and uses a U6 promoter for siRNA expression. The sense sequence shows no homology any mouse or rat mRNA sequence in the NCBI RefSeq database. It can also be used as a siRNA vector; the siRNA may be inserted using BamH I and Hind III for siRNA insertion.

Detailed Map: Polylinker: 78 - 145 U6 Promoter: 4873 - 77 SV40 Promoter: 894 - 1239 Neomycin: 1280 - 2074 pUC ori: 2788 - 3428 Ampicillin: 3576 - 4436

Forward Sequencing Primer: GWM-PR0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)

Reverse Sequencing Primer: GWM-PR0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Storage: Store at -20C

Limited Use Label License: None

Additional Information

Name pRNA-U6.1/Neo/CTL
Availability Discontinued
Related Product Names pRNA-U6.1/Neo/CTL
Storage Store at -20C
Datasheets/Manuals Printable datasheet for GWM-VEC028
Intended Use Research Use Only