pRNA-U6.1/Zeo (GWM-VEC009)

GWM-VEC009

10ug
$270.00

Description

Description: :pRNA-U6.1/Zeo is a GenWay siRNA expression vector. It is designed for mammalian transfection. It carries a zeomycin resistance gene that can be used for establishing stable cell line. It uses U6 promoter for siRNA expression.

Detailed Map: Polylinker: 628 - 651 U6 Promoter: 301 - 627 SV40 Promoter: 1254 - 1600 Zeomycin: 1688 - 2062 pUC ori: 2732 - 3375 Ampicillin: 3523 - 4383

Forward Sequencing Primer: GWM-PR0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)

Reverse Sequencing Primer: GWM-PR0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Storage: Store at -20C

Limited Use Label License: None

Additional Information

Name pRNA-U6.1/Zeo (GWM-VEC009)
Related Product Names pRNA-U6.1/Zeo
Datasheets/Manuals Printable datasheet for GWM-VEC009
Storage Store at -20C
Intended Use Research Use Only