pRNAT-H1.1/Neo

GWM-VEC018

10ug
$415.00

Description

Description: :pRNAT-H1.1/Neo is a GenWay siRNA expression vector. It is designed for mammalian transfection. It carries a Neomycin resistance gene as the selectable marker which can be used for establishing stable cell line. The GFP marker (coral GFP, cGFP) under CMV promoter control can be used to track the transfection efficiency. It uses H1 promoter for siRNA expression.

Detailed Map: Polylinker: 6102 - 6125 H1 Promoter: 6002 - 6101 CMV Promoter: 37 - 624 cGFP: 641 - 1360 SV40 Promoter: 2049 - 2394 Neomycin: 2435 - 3229 pUC ori: 3943 - 4583 Ampicillin: 4731 - 5591

Forward Sequencing Primer: GWM-PR0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)

Reverse Sequencing Primer: GWM-PR0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Storage: Store at -20C

Limited Use Label License: The use of CMV promoter is covered under U. S. Patent No. 5,168,062 and 5,385,839 owned and licensed by the University of Iowa Research Foundation and is sold for research use only. Commercial users must obtain a license to these patents directly from the University of Iowa Research Foundation (UIRF), 214 Technology Innovation Center, Iowa City, Iowa 52242. For further information, please contact the Associate Director of UIRF, at 319-335-4546.

Additional Information

Name pRNAT-H1.1/Neo
Availability Discontinued
Related Product Names pRNAT-H1.1/Neo
Storage Store at -20C
Datasheets/Manuals Printable datasheet for GWM-VEC018
Intended Use Research Use Only