pRNAT-H1.1/Shuttle (GWM-VEC012)

GWM-VEC012

10ug
$415.00

Description

Description: :pRNAT-H1.1/Shuttle is an adenoviral siRNA shuttle vector. It is compatible with the Clontech Adeno-XTM Expression System 1. It carries a GFP marker (coral GFP, cGFP) under CMV promoter control. This marker can be used to track the transfection efficiency. It uses an H1 promoter for siRNA expression.

Detailed Map: Polylinker: 6164 - 6187 H1 Promoter: 6064 - 6163 CMV Promoter: 37 - 624 cGFP: 641 - 1357 SV40 Promoter: 2085 - 2430 Neomycin: 2471 - 3265 pUC ori: 3979 - 4619 Ampicillin: 4767 - 5627

Forward Sequencing Primer: GWM-PR0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)

Reverse Sequencing Primer: GWM-PR0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Storage: Store at -20C

Limited Use Label License: None

Additional Information

Name pRNAT-H1.1/Shuttle (GWM-VEC012)
Related Product Names pRNAT-H1.1/Shuttle
Datasheets/Manuals Printable datasheet for GWM-VEC012
Storage Store at -20C
Intended Use Research Use Only