pRNAT-U6.1/Neo (GWM-VEC014)

GWM-VEC014

10ug
$415.00

Description

Description: :pRNAT-U6.1/Neo is a GenWay siRNA expression vector. It is designed for mammalian transfection. It carries a Neomycin resistance gene as the selectable marker, which can be used for establishing stable cell line. The GFP marker (coral GFP, cGFP) under CMV promoter control can be used to track the transfection efficiency. It uses U6 promoter for siRNA expression.

Detailed Map: Polylinker: 78 - 101 U6 Promoter: 6131 - 77 CMV Promoter: 140 - 727 cGFP: 745 - 1463 SV40 Promoter: 2152 - 2497 Neomycin: 2538 - 3332 pUC ori: 4046 - 4686 Ampicillin: 4834 - 5694

Forward Sequencing Primer: GWM-PR0011: pRNA-U6 Forward (TACGATACAAGGCTGTTAGAGAG)

Reverse Sequencing Primer: GWM-PR0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Storage: Store at -20C

Limited Use Label License: None

Additional Information

Name pRNAT-U6.1/Neo (GWM-VEC014)
Related Product Names pRNAT-U6.1/Neo
Datasheets/Manuals Printable datasheet for GWM-VEC014
Storage Store at -20C
Intended Use Research Use Only