



Description: :pRNA-H1.1/Shuttle is a GenWay adenoviral siRNA shuttle vector. It is compatible with Clontech Adeno-XTM Expression System 1. It uses H1 promoter for siRNA expression.

Detailed Map: Polylinker: 4753 - 4776 H1 Promoter: 4653 - 4752 SV40 Promoter: 674 - 1019 Neomycin: 1060 - 1854 pUC ori: 2568 - 3208 Ampicillin: 3356 - 4216

Forward Sequencing Primer: GWM-PR0013: pRNA-H1 Forward (TAATACGACTCACTATAGGG)

Reverse Sequencing Primer: GWM-PR0012: pRNA Reverse (TAGAAGGCACAGTCGAGG)

Storage: Store at -20C

Limited Use Label License: None

Additional Information

Name pRNA-H1.1/Shuttle
Availability Discontinued
Related Product Names pRNA-H1.1/Shuttle
Storage Store at -20C
Datasheets/Manuals Printable datasheet for GWM-VEC008
Intended Use Research Use Only